WikiJournal Preprints/MOLECULAR CLONING AND mRNA EXPRESSION OF dmrt1 GENE IN GONADAL DEVELOPMENTAL PERIOD OF COBALTCAP SILVERSIDE HYPOATHERINA TSURUGAE
Article information
Abstract
Hypoatherina tsurugae is an old-world Atheriniformes that exhibits temperature-dependent sex determination and is important as a model to study the effects of global warming and climate change. There is little known about its reproductive biology during the sex determination period. To gain insights, the purpose of this study is to anticipate the role of the dmrt1 gene of Hypoatherina tsurugae during the sex determination/differentiation period. Methods The dmrt1 genes are isolated and cloned successfully in Hypoatherina tsurugae. The phylogenetic tree was constructed by comparing the mRNA sequence of 50 different fishes across various taxa available in the NCBI database and taking out the group as Xenopus laevis. The gene expression study was performed by quantitative RT-PCR. The histological studies of various stages during gonadal sex differentiation were determined by light microscopy. Results Three different dmrt1 transcripts dmrt1a, dmrt1b, and dmrt1c were identified and successfully cloned from testis of amhy+ H. tsurugae. Each transcript has varying lengths dmrt1a - 1231 bp, dmrt1b - 1569 bp, and dmrt1c – 1403 bp that encodes 293 aa, 316 aa, and 265 aa residues respectively. The Phylogenetic tree shows a high homology of H. tsurugae dmrt1 with Maelanotaenia boesemani dmrt1 forming sister clad. From the qRT-PCR result, the expression of the dmrt1 gene is correlated with the expression of the amhy gene significantly reached a peak at 6 wah then decreased. The dmrt1 in amhy+ male expression begins from baseline at 0 wah and it expresses in an increasing fashion that needs for male developmental pathway for testis differentiation whereas in amhy- female individual expression is very low from 0 wah to 10 wah which indicates the low expression needed for differentiation of female sex organ ovary. The histological sections of gonads in different larval stages showed that differentiation of gonads male/female decided at 6 wah. In this stage, the primary oocytes are recognized and correlated with the expression of dmrt1gene. Conclusion Several dmrt1 transcripts have been identified in the Hypoatherina tsurugae species. The dmrt1 gene was highly expressed in amhy+ male individuals as compared to amhy- female. It is concluded that dmrt1 has a significant role in testis differentiation during the gonadal development period in H. tsurugae species. These findings added extra knowledge for a better understanding of molecular mechanisms of sex determination and differentiation period in other fishes.
First Heading
edit
Manuscript text goes re
Introduction
It has been reported that the amhy gene plays a critical role in the male sex determination of the old world Silverside species, Hypoatherina tsurugae (Bej et al., 2017). Other genes and transcription factors have also been identified as master sex-determining genes in various fish species (Hattori et al., 2013, Yano et al., 2012, Takehana et al., 2014, Matsuda et al., 2002, Myosho et al., 2012). These references demonstrate that the genetic machinery controlling gonadal development in fish is diverse and not limited to a particular gene or transcription factor. Interestingly, the sdY immune-related gene can also be involved in sex determination in Salmonids through crosstalk (Yano et al., 2012).
Doublesex and mab-3-related transcription factor 1 (dmrt1) is a transcription factor that is widely conserved across different species. It plays an important role in the development of sex organs by regulating the genes responsible for male and female differentiation (Han et al., 2021). The DM-domain is a highly conserved Zinc finger DNA binding motif that characterizes this gene family. It also serves as a key regulator of sex determination period mostly it activates male differentiation genes and represses the female differentiation genes (Webster et al., 2017). Previous studies have shown that inactivating the dmrt1 gene in sertoli cells results in a significant reduction in the survival rate of gametocytes (Kim et al., 2007). Therefore, dmrt1 is a crucial factor in the development and differentiation of gonads.
The Cobaltcap silverside, also known as Hypoatherina tsurugae, is a species that has limited information about its reproductive biology and sex differentiation. While studies have been conducted on the amhy gene (Bej et al., 2017), the expression of other genes during gonadal determination and differentiation has not been explored. Thus, the objective of this paper is to investigate the expression pattern of the dmrt1 gene in this species and its role during gonadal development.
Materials and Methods
About 100 matured wild cobaltcap silversides were collected by hand net from Tokyo Bay and it was reared in a 500 liter tank to obtain gametes and offsprings for experiments. The tanks were supplied with filtered natural sea water at a rate of 100 ml/min. Larvae were fed rotifers Branchionus rotundiformis and Artemia nauplii from the first day to satiation twice daily and gradually weaned into powdered marine fish food (AQUEON, Franklin, WI).
Genomic DNA was isolated from caudal fin tissue following protocol described by Aljanabi and Martinez (1997). The genotyping of larvae to know male / female are performed by primer Amh 613 F and Amh 35 R (Bej et al., 2017).
Cloning of dmrt1 gene
For cloning, total RNA was isolated Amhy+ individual testis by using TRIzol (Thermo Fisher Scientific, Waltham, MA) following the manufacturer’s instruction. 1 µg of total RNA per sample was reverse transcribed using SuperScript III (Thermo Fisher Scientific) with Oligo-(dT) primers (Merk Millipore, Darmstadt, German) in 20 µl reactions. The PCR was performed amplifications were done according to the following conditions: 3 min at 94 ⁰C, 30 cycles of 30 sec at 94 ⁰C, 45 sec at 60 ⁰C and 2.5 min at 72 ⁰C, then followed by a final elongation for 5 min at 72 ⁰C. PCR products were electrophoresed in 1% agarose gel, purified, and sequenced in an ABI PRISM 3100 capillary sequencer (Life Technologies, Carlsbad, CA) using the BigDye Terminator method. The 5’- and 3’-RACE PCRs are performed using Smart RACE cDNA amplification kit (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol. Sequences were analyzed with GENETYX version 11.0 (GENETYX, Tokyo, Japan). All primers are listed in Table 1.
Real-Time/Quantitative PCR (qRT-PCR)
For expression studies, total RNA was isolated amhy+ and amhy- individual at the interval 2 week after hatch (wah) like 0wah, 2wah, 4wah, 6wah, 8wah and 10wah. The expression level of mRNA transcripts was analyzed by qRT-PCR using specific RT primers designed for Dmrt1 loci using conditions of previous study (Bej et al., 2017). The β-actin gene was taken as an endogenous control because of its stability during sex determination/differentiation period.
Sequence analysis
The multiple alignment software Clustal X was used for alignment of nucleotide sequences and their deduced amino acid sequences. The phylogenetic tree was constructed using MEGAX with Neighbour-Joining method and BioNJ Algorithm to a matrix of pairwise distances estimated in Tamura-Nei model with bootstrap value 10,000 replicates each to determine confidence of tree topology. The neckwick file export to iTOL (https://itol.embl.de) an interactive Tree of Life webserver.
Statistical analysis
The differences in gene expression between groups were analyzed by ANOVA followed by Tukey test using GraphPad prism (v.6.0; GraphPad software, San Diego, CA). Differences in gene expression were considered as statistically significant at P< 0.05.
Histological analysis
Trunk samples were dehydrated through an ascending ethanol series (70%, 90%, 99%, and 100%), cleared in xylene, embedded in Paraplast Plus (McCormick Scientific, St. Louis, MO), sectioned serially with a thickness of 5 µm, and stained with hematoxylin and eosin. Stages of gonadal sex differentiation were determined by light microscopy using histological criteria for another atheriniform, the pejerrey O. bonariensis (Ito et al., 2005, Strüssmann and Ito 2005).
Data Accessibility
DNA sequences: GenBank accessions; Hypoatherina tsurugae dmrt1 [PP103565], Acanthopagrus schlegelii dmrt1 [AY323953.1], Amphiprion ocellaris dmrt1 [XM_023285860.2], Anabas testudineus dmrt1 [XM_026344242.1], Anarrhichthys ocellatus dmrt1 [XM_031870535.1], Anoplopoma fimbria dmrt1 [XM_054610222.1], Archocentrus centrarchus dmrt1 [XM_030723503.1], Astatotilapia calliptera dmrt1 [XM_026187525.1], Chelmon rostratus dmrt1 [XM_041936202.1], Cololabis saira dmrt1 [XM_061730730.1], Cottoperca gobio dmrt1 [XM_029439865.1], Dicentrarchus labrax dmrt1 [XM_051423025.1], Echeneis naucrates dmrt1 [XM_029509970.1], Epinephelus merra dmrt1 [EU555179.1], Etheostoma cragini dmrt1 [XM_034871540.1], Etheostoma spectabile dmrt1 [XM_032515012.1], Fundulus heteroclitus dmrt1 [XM_036144385.1], Gasterosteus aculeatus dmrt1 [NM_001267642.1], Haplochromis burtoni dmrt1 [XM_042220129.1], Hippoglossus hippoglossus dmrt1 [XM_034596836.1], Hippoglossus stenolepis dmrt1 [XM_035166300.2], Kryptolebias marmoratus dmrt1 [XM_017433118.2], Lates calcarifer dmrt1 [XM_018668978.2], Maylandia zebra dmrt1 [XM_004555629.3], Melanotaenia boesemani dmrt1 [XM_042000097.1], Morone saxatilis dmrt1 [XM_035659120.1], Mugil cephalus dmrt1 [XM_047593062.1], Nematolebias whitei dmrt1 [XM_037680854.1], Odontesthes bonariensis dmrt1 [AY319416.3], Oncorhynchus mykiss dmrt1 [NM_001124269.1], Oryzias latipes dmrt1 [NM_001104680.2], Perca flavescens dmrt1 [XM_028578693.1], Perca fluviatilis dmrt1 [XM_039804490.1], Pungitius pungitius dmrt1 [XM_037482384.1], Rachycentron canadum dmrt1 [KX154795.1], Sander lucioperca dmrt1 [XM_031305506.2], Scatophagus argus dmrt1 [MG765300.1], Scomber japonicus dmrt1 [XM_053326146.1], Sebastes schlegelii dmrt1 [KF648596.1], Sebastes umbrosus dmrt1 [XM_037776879.1], Seriola aureovittata dmrt1 [XM_056377194.1], Simochromis diagramma dmrt1 [XM_040003570.1], Siniperca chuatsi dmrt1 [XM_044196976.1], Solea senegalensis dmrt1 [XM_044027229.1], Sparus aurata dmrt1 [XM_030418458.1], Stegastes partitus dmrt1 [XM_008276401.1], Symphysodon haraldi dmrt1 [KX845007.1], Thunnus maccoyii dmrt1 [XM_042420483.1], Toxotes jaculatrix dmrt1 [XM_041042054.1], Xiphias gladius dmrt1 [XM_040155598.1], Xenopus laevis dmrt1 [AB201112.2].
Results
Sequence analysis of dmrt1
Three different dmrt1 transcripts dmrt1a, dmrt1b, dmrt1c was identified and successfully cloned from testis of amhy+ H. tsurugae. Each transcript has varying length, dmrt1a - 1231 bp, dmrt1b - 1569 bp and dmrt1c – 1403 bp that encodes 293 aa, 316 aa and 265 aa residues respectively. The isolated dmrt1a cDNA was 1231 bp with an open reading frame (ORF) of 879 bp, encoding a 293 aa protein (GenBank Accession number – PP103565) (Fig. 1). It is identical to the dmrt1 gene of Melanotaenia boesemani (89.61%), Odontesthes hatcheri (85.37%), Amphiprion ocellaris (85.37%), Odontesthes bonariensis (84.17%), Stegastes partitus (83.22%), Xiphias gladius (83.39%), and Lates calcarifer (83.19%). By using Clustal W software, the amino acid sequence of H. tsurugae 293 aa residues was aligned with 9 other fish species. The results showed that the homology was Melanotaenia boesemani (83.62%), Odontesthes hatcheri (79.18%), Perca fluviatilis (78.67%), Xiphias gladius (78.45%), Odontesthes bonariensis (78.50%), Plectropomus leopardus (76.95%), Oreochromis niloticus (76.19%), and Dicentrarchus labrax (74.33%) (Fig. 2).
A phylogenetic tree was constructed by comparing the mRNA sequence of 50 different fishes across various taxa available in NCBI database and taking out group as Xenopus laevis (Fig. 3). The tree shows a high homology of H. tsurugae dmrt1 with Maelanotaenia boesemani dmrt1 forming sister clad as they are belonging to the same order Atheriniformes.
Gene expression analysis
The expression level of mRNA transcript was analyzed by RT-PCR using specific RT primers of dmrt1 loci. The β-actin gene was taken as an endogenous control because of its stability during sex determination/differentiation period. The result of qRT-PCR displays that in amhy+ male individual the expression of dmrt1 gene is quite high at 6 wah then gradually decreases. In contrast, amhy- female individual it remain at baseline at 0 wah to 10 wah during sex determination and differentiation period (Fig. 4).
The histological sections of gonads in different larval stages showed that differentiation of gonads male/female decided at 6 wah. In this stage the primary oocytes are clearly recognized (Fig. 5) which is also correlated with expression of dmrt1 gene.
Discussion
In the present study, the H. tsurugae dmrt1a, dmrt1b, dmrt1c gene has been successfully isolated, cloned and sequenced. The dmrt1a mRNA is 1231 bp encoding a 293 aa protein. The dmrt1a, dmrt1b and dmrt1c proteins showed a high conservation at the N-terminal region that includes DM-domain. The dmrt1a gene has very close similarity with dmrt1gene of Melanotaenia boesemani, Odontesthes hatcheri, Perca fluviatilis, Xiphias gladius, Odontesthes bonariensis, Plectropomus leopardus, Oreochromis niloticus, and Dicentrarchus labrax. However, the sequence identity was low except for the DM domain that positions from 26th to 90th sequence of amino acids.
The Phylogenetic relationship analysis revealed that all dmrt1 mRNA of different fishes were clustered with their corresponding homologs. The Hypoatherina tsurugae dmrt1 forms sister clad with another Atheriniformes Maelanotaenia boesemani.
The study focused on the expression pattern of the dmrt1/dmrt1a gene in the gonads of H. tsurugae. The qRT-PCR result showed that the expression of the dmrt1 gene is correlated with the expression of the amhy gene, which reached a peak at 6 weeks after hatching (wah) and then decreased (Bej et al., 2017). The expression of amhy was detected before the appearance of the first signs of histological differentiation in the presumptive Sertoli cells surrounding germ cells in the undifferentiated gonads. Similarly, the dmrt1 in amhy+ male expression begins from baseline at 0 wah and gradually increases, indicating the need for the male developmental pathway for testis differentiation. In contrast, in amhy- female individuals, expression is very low from 0 wah to 10 wah, indicating the low expression needed for differentiation of female sex organ ovary. From our previous study, by comparing the expression profiles of amhy and dmrt1 gene of this species it clearly showed that amhy gene is highly expressed than dmrt1 gene at 6 wah during sex determination/differentiation period. So, as transcription factors dmrt1 has its own function in sex differentiation period, probably in the downstream pathway of this species. Similarly, in Odentesthes hatcheri has higher expression during developmental period in testes than ovaries (Hattori et al., 2008). Moreover, in chicken and Chinese tongue sole, the Z-linked dmrt1 duplication is required for male sex determination (Smith et al., 2009, Chen et al., 2014). It also reported dmrt1 is highly expressed in testis of Pengze crucian carp, Atalntic cod, Platyfish (Zheng et al., 2014, Johnson et al., 2010, Veith et al., 2006). The dmrt1 also studied in Zebra fish and Tilapia (Romano et al., 2020, Li et al., 2013) illustrated their critical role in sex determination and differentiation period. It is seen in Zebrafish that the loss of dmrt1 disrupts normal male sexual development from the onset of histological gonadal sex differentiation. Furthermore, foxl2 repression in male required for dmrt1 function, as in other animals (Webster et al., 2017). Loss of dmrt1 resulted male infertility but female has no apparent effect. In this research, the expression of dmrt1 is correlated with the histological analysis of gonads that at 6 wah the gonad is able to differentiate male/female. The dmrt1 is quite low in amhy- female individuals, it confirms that dmrt1 has more involvement in male gonad differentiation rather than female gonad. In juvenile fish, there is no detection of dmrt1 expression in ovaries of Zebrafish whereas testes exhibited clear expression (Webster et al., 2017). Studies on Nile Tilapia revealed that dmrt1 was only expressed in mature testes and it also expressed in gonads of XX Tilapia of sex reversal by androgens (Wang et al., 2010, Li et al., 2021). Thus, expression of dmrt1 was greatly reduced in developing ovaries compared to testes, suggesting a male-specific role during gonadal sex differentiation period.
Conclusion
Multiple transcripts of the dmrt1 gene have been identified in the Hypoatherina tsurugae species. This gene plays an important role in the development of testes and is highly expressed in male individuals with the amhy+ gene. After the sex-determining gene amhy is activated, the dmrt1 gene and other sex-related genes initiate a cascade of events that differentiate the gonads during the sex differentiation period of the H. tsurugae species. However, more functional experiments are needed to further explore the mechanisms of downstream pathways of gene regulation during the gonadal differentiation period of this species.
Subheading
editTable 1. List of Primers used in cloning and qRT-PCR
| Sl.No | Name of Primers | Sequences |
| 1 | dmrt 1F | 5’- GGCAAATTGTAACTAAACTC-3’ |
| 2 | dmrt 2F | 5’- TGCGCAGGTTGCTTTGAGGAG-3’ |
| 3 | dmrt last R | 5’- ATTGCTATAATTTTAATGCAT-3’ |
| 4 | dmrt RT 234 F | 5’- TGGTCCTGAGGTGACGGTTAAG -3’ |
| 5 | dmrt RT 300 R | 5’- GGATCGTCCCTCCACAGAA-3’ |
| 6 | β-actinFw17 | 5’- GCCTGAAACCGGTTCCCTT-3’ |
| 7 | β-actinRv1838 | 5’-TTTTCGGAACACATGTGCACT-3’ |
| 8 | β-actin RT F | 5’-GTGCTGTCTTCCCCTCCATC-3’ |
| 9 | β-actin RT R | 5’-TCTTGCTCTGGGCTTCATCA-3’ |
Third Heading, etc
editAdditional information
editAcknowledgements
editI thank to Yoji Yamamoto and Ricardo S. Hattori for his assistance in this work. I also thank to Prof. Carlos August Strüssmann of Tokyo University of Marine Science and Technology (TUMSAT) for providing me lab facilities.
Competing interests
editNo conflict of interest
Ethics statement
editNot Applicable
References
editAljanabi SM, Martinez I. (1997). Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acids Research, 25:4692–4693.
Bej DK, Miyoshi K, Hattori RS, Strüssmann CA, Yamamoto Y. (2017). A duplicated, truncated, amh gene is involved in male sex determination in an old world silverside. Genes, Genomes, Genetics, 7: 2489 – 2495.
Chen S, Zhang G, Shao C, Huang Q, Liu G, Zhang P, Song W, An N, Chalopin D. et al., (2014). Whole genome sequence of a flat fish provides insights into ZW sex chromosome evolution and adaptation to a benthic life style. Nature Genetics, 46: 253 – 260.
Han C, Wang C, Ouyang H, Zhu Q, Huang J, Han L, Li S, Li G, Lin H, Zhang Y. (2021). Characterization of dmrts and their potential role in gonadal development of mandarin fish (Siniperca chuasti). Aquaculture Reports, 21:100802
Hattori RS, Fernandino JI, Strüssmann CA, Somoza GM, Yokota M, Watanabe S. (2008). Characterization and expression profiles of Dmrt1, Amh, SF1 and P450aro genes during gonadal sex differentiation in Patagonian pejerrey Odontesthes hatcheri. Cybium, 32(2): 95 – 96.
Hattori RS, Strüssmann CA, Fernandino JI, Somoza GM. (2013). Genotypic sex determination in teleosts: Insights from the testis-determining amhy gene. General Comparative and Endocrinology 192:55–59.
Ito LS, Yamashita M, Takashima F, Strüssmann CA. (2005). Dynamics and histological characteristics of gonadal sex differentiation in Pejerrey (Odontesthes bonariensis) at feminizing and masculinizing temperatures. Journal of Experimental Zoology, 303A: 504-514.
Johensen H, Seppola M, Torgersen JS, Delghandi M, Anderson O. (2010). Sexually dimorphic expression of dmrt1 in immature and mature Atlantic cod (Gadus morhua L.) Comparative Biochemistry and Physiology Part B Biochemistry and Molecular Biology 156: 197 – 205.
Kim S, Bardell VJ, Zarkower D. (2007). Cell type autonomous and non-autonomous requirements for Dmrt1 in postnatal testis differentiation. Developmental Biology, 307: 314 – 327.
Li MH, Yang HH, Li MR, Sun YL, Jiang XL, Xie QP, Wang TR, Shi HJ, Sun LN, Zhou LY, Wang DS. (2013). Antagonistic roles of Dmrt1 and Foxl2 in sex differentiation via estrogen production in tilapia as demonstrated by TALENs. Endocrinology, 154: 4814 – 4825.
Li H, Zhu Q, Chen R, Liu M, Xu D. (2021). Identification and characterization of dimorphic expression of sex-related genes in Rock Bream, a fish with multiple sex chromosome. Frontiers in Genetics, 12:791179
Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, Kobayashi T, Morrey CE, et al., (2002). DMY is a Y – specific DM – domain gene required for male development in the medaka fish. Nature, 417:559–563.
Myosho T, Otake H, Masuyama H, Matsuda M, Kuroki Y, et al., (2012). Tracing the emergence of a novel sex-determining gene in Medaka, Oryzias luzonensis. Genetics, 191:163–170.
Romano S, Kaufman OH, Marlow FL. (2020). Loss of dmrt1 restores female fates in the absence of cyp19a1a but not rbpms2a/b. Development, 147, dev190942.
Smith CA, Roeszler KN, Ohnesorg T, Cummins DM, Farlie PG, Doran TJ, Sinclair AH. (2009). The avian Z-linked gene DMRT1 is required for male sex determination in the chichen. Nature, 461: 267 – 271.
Strüssmann CA, Ito LS. (2005). Where does gonadal sex differentiation begin? Gradient of histological sex differentiation in the gonads of Pejerrey, Odontesthes bonariensis (Pisces, Atherinidae). Journal of Morphology, 265: 190-196.
Takehana Y, Matsuda M, Myosho T, Suster ML, Kawakami K, et al., (2014). Co-option of Sox3 as the male-determining factor on the Y chromosome in the fish Oryzias dancena. Nature, 5: 4157.doi:10.1038/ncomms5157.
Veith AM, Schfer M, Klüver N, Schmidt C, Volff JN. (2006). Tissue – specific expression of dmrt genes in embryos and adults of the platyfish Xiphophorus maculatus. Zebrafish, 3(3), 325 – 337.
Wang DS, Zhou LY, Kobayashi T, Matsuda M, Shibata Y, Sakai F, Nagahama Y. (2010). Doublesex and Mab-3-related transcription factor-1 repression of aromatase transcription, a possible mechanism favoring the male pathway in tilapia. Endocrinology, 151: 1331 – 1340.
Webster KA, Schach U, Ordaz A, Steinfeld JS, Draper BW, Seigfried KR. (2017). Dmrt1 is necessary for male sexual development in Zebrafish. Developmental Biology, 422: 33 – 46.
Yano A, Guyomard R, Nicol B, Jouanno E, Quillet E, Klopp C, Cabau C, Bouchez O, Fostier A, Guiguen Y. (2012). An immune – related gene evolved into the master sex determining gene in rainbow trout, Oncorhynchus mykiss. Current Biology, 22:1423–1428.
Zheng Y, Liang H, Xu P, Li M, Wang Z. (2014). Molecular cloning of Pcc-dmrt1s and their specific expression patterns in Pengze crucian carp (Carrassius auratus var. Pengze) affected by 17α-methyltestosterone. Fish Physiology and Biochemistry, 40:1141-1155.